Process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons useful for sex determination

摘要

An improved process for simultaneous preparation of sex specific and gender-neutral semisynthetic amplicons obtained by amplifying sequences of synthetic oligonucleotide primers identified as SEQ ID NOS:4 to 7 (5′GGATCCCTATlAGTG 3′; 5′GGATCCCITTTGCACTC 3′; 5CGAAATCGGTAGACGATACG3′ and 5′GGGGATAGAGGGACTTGAAC 3′) useful for sex determination, said process comprising isolating nucleic acids from any part of a papaya plant by conventional methods, amplifying the said nucleic acids in a conventional Random Amplification of polymorphic DNA Polymerase Chain Reaction (RAPD-PCR), resolving the amplified products by conventional electrophoresis method, eluting the sex specific, double stranded amplified product from the gel piece by known methods, cloning the said product in a known vector by conventional methods, sequencing the said cloned product by known methods, synthesizing the single stranded chains of synthetic oligonucleotides by known method based on the said sequence data, amplifying the said nucleic acid in a Conventional Sequence Tagged Site Polymerase Chain Reaction by using synthetic oligonucleotides as primers to get sex specific and gender-neutral semisynthetic amplicons simultaneously.