Method for detecting pathogenic leptospires using the rpoB gene

摘要

Use of rpoB gene for in vitro diagnosis of a pathogenic strain of Leptospira, is claimed. Independent claims are included for: (1) in vitro method to detect the presence of at least one pathogenic strain of Leptospirain a biological sample comprising analysis of biological sample for sequence having at least 85% of identity with the sequence of the region 98-237 (SEQ ID NO: 2) of the rpoB gene of Leptospira interrogans serovar Copenhagen, in which the detection of the sequence indicates the presence of at least one pathogenic Leptospirastrain in the sample; and (2) a kit for detecting the presence of at least one pathogenic strain of Leptospirain the biological sample containing at least one oligonucleotide comprising: DNA sequence of SEQ ID NO: 25 (comprising gtcttgcctt ccgagtcg), SEQ ID NO: 26 (comprising tctgcaagagttrttgaccatc) or SEQ ID NO: 27 (comprising cgcacgtccgagcatatcgtcg); DNA sequence complementary to the sequences; RNA sequence corresponding to SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27; and RNA sequence complementary to the sequences.