Set of oligonucleotide probes and methods for making the microbiota profile

摘要

A set of oligonucleotide probes, said assembly comprising: (a) an oligonucleotide consisting of (i) a nucleotide sequence selected ACGCTTGCACCCT (SEQ ID NO 1), optionally with up to three substituted bases, and AGGGTGCAAGCGT (SEQ ID NO 27) optionally substituted with up to three bases, and (aii) 0-5 nucleotides in addition to (i) wherein the oligonucleotide (a) is capable of hybridizing with SEQ ID NO 27 or SEQ ID NO 1, respectively, under conditions high stringency; (B) an oligonucleotide consisting of (bi) a nucleotide sequence selected CGATCCGAAAACCTTCTTCACT (SEQ ID NO 2), optionally with up to three substituted bases, and AGTGAAGAAGGTTTTCGGATCG (SEQ ID NO 28), optionally with up to three substituted bases, and ( bii) 0-5 nucleotides in addition to (bi), in which the oligonucleotide (b) is capable of hybridizing with SEQ ID NO 28 or SEQ ID NO 2, respectively, in high stringency conditions; (C) an oligonucleotide consisting of (ci) a nucleotide sequence selected GGACAACGCTTGCCAC (SEQ ID NO 3), optionally with up to three substituted bases, and GTGGCAAGCGTTGTCC (SEQ ID NO 29), optionally with up to three substituted bases, and ( cii) 0-5 nucleotides in addition to (ci), wherein the oligonucleotide (c) is capable of hybridizing with SEQ ID NO 29 or SEQ ID NO 3, respectively, in high stringency conditions; (D) an oligonucleotide consisting of (di) a nucleotide sequence selected CGTAGGCGGTTCGTCGCGT (SEQ ID NO 4), optionally with up to three substituted bases, and ACGCGACGAACCGCCTACG (SEQ ID NO 30), optionally with up to three substituted bases, and ( dii) 0-5 nucleotides apart from (di), where the oligonucleotide (d) is capable of hybridizing with SEQ ID NO 30 or SEQ ID NO 4, respectively, in high stringency conditions; and (e) one or more oligonucleotides consisting of (i) a nucleotide sequence selected from those listed as SEQ ID NO 5-8 and 31-34 in Table 1, optionally substituted with up to three bases, and (eii) 0 -5 addition to (i) nucleotides in the oligonucleotide (e) is capable of hybridizing with the nucleotide sequence complementary to SEQ ID NO 5-8 and 31-34, respectively, in high stringency conditions; and optionally (f) one or more oligonucleotides consisting of (fi) a nucleotide sequence selected from those listed as SEQ ID NO 9-26 and 35-52 in Table 2 and Table 3, optionally substituted with up to three bases ( fii) 0-5 nucleotides in addition to (fi), in which the oligonucleotide (f) is capable of hybridizing with the nucleotide sequence complementary to SEQ ID NO 9-26 and 35-52, respectively, in high stringency conditions.