Oligonucleotide primers for detecting wheat fungal pathogen Puccinia recondita and method for detecting it

摘要

the application concerns the oligonukleotydu00f3w,for identifying the presence of genetic material of the pathogen puccinia recondita fungoid in the biological material using the polymerase chain reaction or modyfikacji.the object of the application is a pair of specific primers oligonukleotydowych species for use in polymerase chain reaction or its modificationabout: lidpr1 sequences: 5 '- ccgtcgttgagccctacaat - 3': 5 '- lidpr2 taaggtcaccgtaggtgggt - 3' complementary to specific species of puccinia recondita genome sequence.the notification covers how pathogen detection fungoid wheat puccinia recondita,when it comes to specific dna amplification fragment length 120 - 160 pairs in the pcr reaction using a pair of primers oligonukleotydowych.