Mumps virus attenuation method, mumps virus, and live vaccine

摘要

Provided is a mumps live vaccine having reduced CNS pathogenicity while maintaining efficacy by using a reliable technique for introducing an miRNA complementary sequence rather than unreliable production by subculture. The primary target tissue of MuV in the central nervous system was discovered to be choroid plexus ependymal cells present on the surface of the inside of the cerebral ventricles, rather than nerve cells. Incorporating a sequence into the mumps virus that is complementary to the miRNA expressed at a high level in the choroid plexus attenuates the mumps virus. In particular, focusing on the miRNA referred to as "miR449" expressed specifically in the choroid plexus, the present invention is characterized in that at least two connected sequences of ACCAGCTAACAATACACTGCCA or ACCAGCTAACAATACACTGCCA, which are sequences complementary to miR449, are incorporated into the mumps virus.