The Operon Encoding Hydrolytic Dehalogenation of 4-Chlorobenzoate Is Transcriptionally Regulated by the TetR-Type Repressor FcbR and Its Ligand 4-Chlorobenzoyl Coenzyme A

摘要

The bacterial hydrolytic dehalogenation of 4-chlorobenzoate (4CBA) is a coenzyme A (CoA)-activation-type catabolic pathway that is usually a common part of the microbial mineralization of chlorinated aromatic compounds. Previous studies have shown that the transport and dehalogenation genes for 4CBA are typically clustered as an fcbBAT1T2T3C operon and inducibly expressed in response to 4CBA. However, the associated molecular mechanism remains unknown. In this study, a gene ( fcbR ) adjacent to the fcb operon was predicted to encode a TetR-type transcriptional regulator in Comamonas sediminis strain CD-2. The fcbR knockout strain exhibited constitutive expression of the fcb cluster. In the host Escherichia coli , the expression of the P_(fcb) -fused green fluorescent protein ( gfp ) reporter was repressed by the introduction of the fcbR gene, and genetic studies combining various catabolic genes suggest that the ligand for FcbR may be an intermediate metabolite. Purified FcbR could bind to the P_(fcb) DNA probe in vitro , and the metabolite 4-chlorobenzyl-CoA (4CBA-CoA) prevented FcbR binding to the P _(fcb) DNA probe. Isothermal titration calorimetry (ITC) measurements showed that 4CBA-CoA could bind to FcbR at a 1:1 molar ratio. DNase I footprinting showed that FcbR protected a 42-bp DNA motif (5′- GGAAATCAATAGGTCCATAGAAAATCTATTGACTAATCGAAT -3′) that consists of two sequence repeats containing four pseudopalindromic sequences (5′-TCNATNGA-3′). This binding motif overlaps with the ?35 box of P_(fcb) and was proposed to prevent the binding of RNA polymerase. This study characterizes a transcriptional repressor of the fcb operon, together with its ligand, thus identifying halogenated benzoyl-CoA as belonging to the class of ligands of transcriptional regulators.IMPORTANCE The bacterial hydrolytic dehalogenation of 4CBA is a special CoA-activation-type catabolic pathway that plays an important role in the biodegradation of polychlorinated biphenyls and some herbicides. With genetic and biochemical approaches, the present study identified the transcriptional repressor and its cognate effector of a 4CBA hydrolytic dehalogenation operon. This work extends halogenated benzoyl-CoA as a new member of CoA-derived effector compounds that mediate allosteric regulation of transcriptional regulators.